Tamoxifen for the treatment of myeloproliferative neoplasms: A … – Nature.com

Study design and oversight

The main goal of the TAMARIN study (EudraCT 2015-005497-38) was to obtain preliminary information on the safety and therapeutic activity of tamoxifen in MPN. TAMARIN is an investigator-driven Aherns design Phase II multicenter study approved by NHS Health Research Authority (IRAS 201126). The study was conducted in accordance with the Declaration of Helsinki and UK regulations (The Medicines for Human Use (Clinical Trials) Regulations 2004). The clinical trial authorization was provided by the Medicines and Healthcare products Regulatory Agency. The protocol was approved by the ethics committees of all involved institutions and is available with the full text of this article. The Clinical Study Protocol and the Statistical Analysis Plan, including the sample size calculations, interim safety analysis, analysis methods, Bayesian analysis, hematological response, and other exploratory outcomes are available in the Supp. Note. The authors designed the study, collected and analyzed the data, and wrote or edited the manuscript for submission.

This study was approved by NHS Health Research Authority (IRAS 201126). The study was conducted in accordance with the Declaration of Helsinki and UK regulations (The Medicines for Human Use (Clinical Trials) Regulations 2004). The clinical trial authorization was provided by the Medicines and Healthcare products Regulatory Agency. The study was registered on ISRCTN on 20-Jun-2016 (https://www.isrctn.com/ISRCTN65011803). Eligibility criteria included MPN patients aged 60 years, with eligible women being post-menopausal (defined as amenorrhoeic for at least 12 consecutive months following cessation of all exogenous hormonal treatments); confirmed diagnosis of JAK2-V617F, CALR 5bp insertion (exon 9), or CALR 52bp deletion (exon 9) positive ET, PV, or MF (primary or secondary) for 6 months. JAK2-V617F, CALR 5bp insertion (exon 9), or CALR 52bp deletion (exon 9) mutant allele burden 20% in peripheral blood granulocyte DNA at study entry (assessed via central review); WHO performance status 02. For patients with PV or ET, maintenance of platelet count 600109/L, WBC25109/L and venesection requirements 1 per month for the previous 3 months prior to registration, without introduction of any new therapeutic agents for their MPN for 6 months prior to registration. For patients with MF, eligible patients showed no evidence of disease progression defined by IWG-MRT ELN criteria or new therapeutic agents introduced for a 6-month period before registration. Patients receiving cytoreductive therapy (with the exception of interferon alpha or investigational agents) for their MPN (not solely aspirin or venesection) were included, and this therapy was continued throughout. Adequate hepatic function, defined as bilirubin 1.5 upper limit of normal (ULN) (patients with elevated bilirubin due to Gilberts syndrome were eligible) or AST/ALT/ALP2.5 x ULN, and adequate renal function (creatinine clearance >30mL/min) were required. Male patients agreed to use effective contraception during participation in the trial and for 2 months after the last dose of trial treatment. All patients provided written informed consent. The Ethics statement and consent form included the use of human peripheral blood mononuclear cells for research.

Exclusion criteria included leukemic transformation (>20% blasts in blood, marrow or extramedullary site); accelerated phase of disease as indicated by 10% blasts in the peripheral blood); treatment of ET, PV, or MF with Interferon alpha or other investigational agents for their MPN within 6 months prior to trial entry (JAK inhibitors, such as ruxolitinib, were allowed if taken continuously for 6 months prior to registration); any of the following previous thrombotic events at any time: portal or other splanchnic venous thrombosis; vascular access complication; ischemia cerebrovascular; stroke; transient ischemic attack; superficial thrombophlebitis; venous thromboembolic events including pulmonary embolism (PE) and deep vein thrombosis (DVT); peripheral vascular ischemia; visceral arterial ischemia; acute coronary syndrome; myocardial infarction; previous malignancy within 5 years with the exception of adequately treated cervical carcinoma in situ or localized non-melanoma skin cancer; previous endometrial cancer, hyperplasia or polyps; prior treatment with hematopoietic stem cell transplantation; patients who did not carry JAK2-V617F,CALR 5bp insertion (exon 9) or CALR 52bp deletion (exon 9) mutations or whose allele burden was <20% at study entry (assessed via central review); female patients receiving hormone replacement therapy; hypertriglyceridemia > grade 1; any serious underlying medical condition (at the judgment of the Investigator), which could impair the ability of the patient to participate in the trial (e.g. liver disease, active autoimmune disease, uncontrolled diabetes, uncontrolled infection (HIV, Hepatitis B and C), known genetic defect (apart from MPN) relating to venous thromboembolic events, or psychiatric disorder precluding understanding of trial information); known hypersensitivity to tamoxifen or hypersensitivity to any other component of tamoxifen; concomitant drugs contraindicated for use with the trial drug according to the Summary of Product Characteristics; known planned scheduled elective surgery during study with the exception of dental and low risk eye surgery (e.g. cataracts).

The Trial Scheme for Eligibility and Central Analysis is summarized in Supp. Fig.1.

Tamoxifen was provided at the common dose used in ER+ breast cancer (20mg oral daily, progressively escalated to 40mg daily upon good tolerance and when there was no hematological response or mutant allele burden reduction at 12w). All patients received trial treatment for 24 weeks. Treatment continuation was encouraged but not mandated after 24w for patients who did not experience persistent side effects greater than grade 1 or thrombotic events of any grade and that fulfilled one or more of the following criteria at 24 weeks: 25% reduction in allele burden compared to baseline; improvement of hematological response compared to baseline without changes in cytoreductive therapy dose according to 2009 ELN criteria for ET/PV patients and to IWG-MRT response criteria for MF patients; a decrease in requirement for cytoreduction without deterioration of hematological response compared to baseline according to 2009 ELN criteria for ET/PV patients and to IWG-MRT response criteria for MF patients. Their response was reassessed after 36 and 48 weeks of treatment as applicable. The Study Protocol is available in the Supp. Note.

The original sample size target of 42 was based on an AHerns design and power of 80%. An alternative approach adopted a Bayesian framework to adjust to the total 38 patients recruited. A beta-binomial conjugate analysis confirmed an equal probability with the original AHerns design and the Bayesian framework considering the 38 patients recruited and concluded that the primary outcome would need to be observed in at least 3 patients to meet the success criteria. The primary endpoint was a reduction in the peripheral blood JAK2V617F, CALR 5bp insertion (exon 9) or CALR 52bp deletion (exon 9) mutant allele burden of 50% at 24 weeks. Under the Ahern design, it was necessary to observe at least 3 successes (i.e. reductions in allele burden of 50% in the 38 patients recruited). Secondary outcomes were the proportion of patients with a reduction in the peripheral blood JAK2-V617F, CALR 5bp insertion (exon 9), or CALR 52bp deletion (exon 9) mutant allele burden of 50% at 12 weeks; toxicity measured as the number of grade 3 and 4 adverse events reported; the number of thrombotic events of any grade reported and validated; duration of hematological response calculated as time from registration to progression for patients who entered the study in response (CR or PR). For patients who entered the trial in stable disease, the time between first recorded response to the date of progression. Progression was defined as loss of response for PV/ET patients and evidence of disease progression for MF patients. PV/ET patients who continued to achieve a response, or MF patients who had no evidence of disease progression at the end of the trial were censored at date last seen. Hematological response was defined according to 2009 ELN criteria for ET/PV patients62 and no evidence of disease progression for MF patients according to IWG-MRT response criteria;63 proportion of patients in each response category according to IWG-MRT response criteria63 for MF patients and 2013 ELN response criteria64 for ET/PV patients at 24 weeks of treatment; proportion of patients showing an improvement in response category at 24 weeks compared to baseline according to 2009 ELN criteria for ET/PV patients62 and according to IWG-MRT response criteria63 for MF patients; patients who are in a higher category at week 24 compared to baseline were classed a success; patients who enter the trial in CR and who maintain a CR were classed as a success in this outcome. Exploratory outcomes included the proportion of patients showing a decrease in allele burden at 12 and 24 weeks compared to baseline was presented as the number of patients who have shown a decrease of any amount between baseline and week 12 or between baseline and week 24; proportion of patients showing a decrease in requirement for cytoreduction therapy at 24 weeks compared to baseline; proportion of patients showing a decrease in allele burden of 50% at 36 and 48 weeks compared to baseline; duration of reduction in the peripheral blood JAK2-V617F, CALR 5bp insertion (exon 9), or CALR 52bp deletion (exon 9) mutant allele burden, defined as time from first observed reduction of 50% until reduction from baseline becomes <25%; RNAseq studies on CD34+ HSPCs isolated from peripheral blood at different time points throughout the study.

For the exploratory outcomes, statistical analysis was performed with GraphPad Prism 9. P<0.05 was considered statistically significant. All data of laboratory experiments are presented as meanSEM. Prism software (GraphPad Software) was used for all statistical analyses. Measurement was taken from different samples with at least three biological replicates. No statistical method was used to predetermine sample sizes. No data were excluded from the analyses. The experiments were not randomized. The investigators were not blinded to allocation during in vitro or animal experiments and outcome assessment.

The MPN cell lines HEL, UKE-1, and SET2 were obtained from the American Type Culture Collection (ATCC; http://www.atcc.org, Manassas, VA). The MARIMO cell line was kindly provided by Dr Juan Li (Wellcome-MRC Cambridge Stem Cell Institute). The estrogen receptor-positive breast cancer MCF-7 were provided by Dr Jason Carroll (Cancer Research UK). HEL, SET2 and MARIMO cells were cultured in phenol red-free RPMI-1640 medium (Thermo Fisher Scientific, Cat. No. 32404014) supplemented with 10% Charcoal Stripped fetal bovine serum (Thermo Fisher Scientific, Cat. No. 12676029) and antibiotics (penicillin, 100 I.U. /ml; streptomycin, 100g/ml). UKE-1 cells were cultured in phenol red-free IMDM medium (Thermo Fisher Scientific, Cat. No. 21056023) supplemented with 10% Charcoal Stripped fetal bovine serum, antibiotics (penicillin, 100 I.U./ml; streptomycin, 100g/ml), 10% heat-inactivated horse serum (Thermo Fisher Scientific, Cat. No. 26050070) and 1M hydrocortisone (Sigma-Aldrich, Cat. No. H0888). MCF-7 cells were cultured in DMEM medium (Thermo Fisher Scientific, Cat. No. 10569010) supplemented with 10% heat inactivated fetal bovine serum (Thermo Fisher Scientific, Cat. No. 26140079) and antibiotics (penicillin, 100 I.U. /ml; streptomycin, 100g/ml). Ba/F3 cells were cultured in phenol red-free RPMI medium supplemented with 10% Charcoal Stripped fetal bovine serum, antibiotics (penicillin, 100 I.U./ml; streptomycin, 100g/ml), and 10ng/ml recombinant murine IL-3 (PeproTech, Cat. No. 213-13).

Cells were cultured at 37C with 5% CO2 in a water-jacketed incubator.

Age-matched, wild-type female C57BL/6J mice (Charles River Laboratories) were used for in vivo treatments and as recipients of bone marrow transplantation assays to generate MPN model, as previously described22. Mice were housed in specific pathogen-free facilities. All experiments using mice followed protocols approved by the Animal Welfare Ethical Committees (AWERB) at the University of Cambridge (PPL P0242B783). All experiments were compliant with UK regulations.

MPN was induced by transplantation of 2*106 bone marrow nucleated cells from Vav-iCre;JAK2V617F mice65 into lethally irradiated C57BL/6J recipients. MPN phenotype was confirmed by high circulating platelet (over 1.5*109 platelets/ml blood) in recipient mouse. The humane endpoints considered were any of these: animal subdued (not moving and only responsive to gentle stimulus); animal losing 15% of basal body weight; animal losing 10% of basal body weight and shows piloerection, inactivity, or a hunched posture as a sign of pain. For short treatments (2 weeks), mice were injected i.p. with 14 or 140mg/kg body weight of tamoxifen (Sigma-Aldrich, Cat. No. T5648) or vehicle (corn oil, Sigma-Aldrich, Cat. No. C8267), three times per week on alternate days. Mouse lineage-negative hematopoietic cell population was collected by immunomagnetic depletion of lineage-committed cells from mouse bone marrow (Mouse Hematopoietic Progenitor (Stem) Cell Enrichment Set, BD Bioscience, Cat. No. 558451).

Laboratory correlative studies investigated possible biomarkers of response based on the transcriptome of peripheral blood CD34+ HSPCs. After ficoll centrifugation of blood, mononuclear cells were subjected to red blood cell lysis and CD34+ HSPCs were immunomagnetically isolated using the Ultrapure CD34 microbead kit (Miltenyi Biotec, Cat. No. 130-100-453) suing AUTOMACS (Miltenyi Biotec). RNA was extracted using Trizol (Invitrogen, Cat. No. 15596026). Briefly, the Smart-seq2 protocol was implemented with improved reverse transcription, template switching and preamplification to increase both yield and length of cDNA libraries generated from individual cells. The Illumina-compatible cDNA sequencing library was prepared with Nextera XT DNA Library Preparation Kit (Illumina, Cat. No. FC-131-1096). The quality, quantity, and the size distribution of the Illumina libraries were determined using the DNA-1000 Kit (Agilent Bioanalyzer, Cat. No. 5067-1504). Libraries were sequenced on the Novaseq 6000 (Illumina). Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adapter contaminations were removed from reads using cutadapt software tool (MIT) and the resulting reads were mapped and quantified on the transcriptome using RSEM v1.1766. Only genes with more than 2 counts per million in at least 2 samples were considered for statistical analysis. The RNAseq data from CD34+ HSPCs of study subjects has been deposited in GEO under the Accession Number GSE172022.

For RNA-Seq of JAK2V617F-mutated human cells lines, HEL cells and UKE-1 cells cultured with or without horse serum (UKE-1+/-HS respectively) were treated with 10M tamoxifen or vehicle for 4h and RNA was extracted from tamoxifen-treated cells by Trizol (Invitrogen, Cat. No. 15596026) and cleaned-up with RNeasy Mini Columns (Qiagen, Cat. No. 74104). RNA-Seq libraries were prepared from total RNA using poly(A) enrichment of the mRNA and sequenced by HiSeq 4000 (Illumina). The RNAseq data from HEL cells and UKE-1 cells has been deposited in GEO under the Accession Number GSE172023.

Differential expression analysis was performed using DESeq2 package67. Gene-set enrichment analyses (GSEA) was performed against the collection of curated gene sets available in the Molecular Signatures Database (http://www.broadinstitute.org/gsea/msigdb/index.jsp), including KEGG, Biocarta and Reactome pathways as well as a collection of gene expression signatures associated with chemical or genetic perturbations. Significance of gene set enrichment between the two conditions was assessed with GSEA software as previously described68 (http://www.broadinstitute.org/gsea/index.jsp), using a weighted statistic, ranking by signal to noise ratio and 1000 gene-set permutations. GSEA output using GO dataset was prepared for Integrative pathway as previously described69. The node cut-off for q-value is 0.005 and 0.1 for responder and non-responder network respectively. Integrated pathway enrichment map is visualized by Cytoscape70.

Human peripheral blood mononuclear cells (PMNCs) were cultured in StemSpan Hematopoietic Cell Media (Stemcell Technologies, Cat. No. 100-0073) supplemented with StemSpan CC100 cytokine cocktail (Stemcell Technologies, Cat. No. 2690), 5mM L-glutamine and antibiotics (penicillin, 100 I.U. /ml; streptomycin, 100g/ml). The cells were seeded at a density of 1106 cells/ml and treated with 4OH-TAM (10M) (Sigma-Aldrich, Cat. No. H6278) or vehicle for 24h. To perform CFU assay, PMNCs were plated in StemMACS HSC-CFU complete with Epo (Miltenyi Biotec, Cat. No. 130-091-280) at a density of 5104 cells/ml. Cultures were incubated at 37C for 14 days.

For measurement of pSTAT5, cell lines were washed and replated at 106 cells/ml in basal media (phenol red-free IMDM or RPMI) without serum for 2h. Cells were treated with 4OH-TAM (5M, 10M and 15M) or vehicle for 45min and were subsequently stimulated with recombinant human THPO (100ng/ml) (Peprotech, Cat. No. 300-18) or EPO (5 U/ml) (Peprotech, Cat. No. P8783) for 15min. Cells were washed with PBS and fixed in 2% paraformaldehyde at 37C for 10min, centrifuged, washed once in p-STAT staining buffer (PBS, pH 7.2, with 0.2% BSA and 0.09% sodium azide) and permeabilized in 100% ice cold methanol on ice for 30min as previously described71. Cells were washed twice with pSTAT staining buffer and labeled with antipY694-STAT5 (BD Biosciences, clone 47, Cat. No. 562076, RRID: AB_11154412) or isotype control (BD Biosciences, clone MOPC-21, Cat. No. 557732, RRID: AB_396840) for 20min. Cells were washed once in pSTAT staining buffer.

To measure apoptosis, cell lines were seeded at 106 cells/ml in growth medium and treated with 4OH-TAM (5M, 10M, 15M, and 20M) or vehicle. After 24h and 48h incubation, 2105 cells were harvested, washed with Annexin V binding buffer (140mM NaCl, 4mM KCl, 0.75mM MgCl2, and 10mM HEPES in bidistilled water, pH 7.4) and labeled using the FITC Annexin V antibody (BioLegend, Cat. No. 640906, RRID: AB_2561292, 1:100) and DAPI (Thermo Fisher Scientific, Cat. No. D1306). The fraction of live cells was determined by selecting Annexin- DAPI- cells. Cells were analyzed with a Gallios Flow Cytometer using Kaluza software (BD Biosciences).

To detect the mutation type in patient HSPCs, DNAs extracted using the QiampDNA mini kit (Qiagen, Cat. No. 51304) from patient granulocyte samples were standardized to 20ng/ul and all samples tested at each time-point. Samples were excluded if they didnt meet acceptance criteria of more than 60% mature granulocytes in DNA preparation, cell viability at freezing <95%, and less than 36h in transit. A repeat blood sample was requested in these cases. JAK2V617F mutation analysis was performed as previously described72. A similar mutation-specific primer approach was used for CALR 52bp deletions, and quantified against the relative amount of product of CALR exon 9/intron 9 with primers lying outside the mutated region of the gene. All samples were run in triplicate and products were normalized to the relevant plasmid standard and the test mean expressed as a percentage of the control region mean value. Primer sequence for CALR wild-type and 5bp insertion is 5 GCAGCAGAGAAACAAATG 3 (forward) and 5 GCCTCTCTACAGCTCGTCCTT 3 (reverse). Reverse primer for CALR 52bp deletion is same with CALR wild-type and 5bp insertion but the specific forward primer for CALR 52bp deletion is 5 ACAGGACGAGGAGCAGAGAAC 3. The probe sequence for wild-type and CALR 52bp deletion is 56FAM-TGAGGATGAGGAGGATGAGG-BHQ1 3. The sequence of specific probe for CALR 5bp insertion is 5 6FAM GTC[+C]TCATCATCCT[+C]CTT - BHQ1 3.

The expression levels of nuclear estrogen receptors and membranal receptor in MPN cell lines were determined by qRT-PCR using standard methodologies. Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Cat. No. 74104), and 500ng was used in a reverse transcriptase reaction (High-Capacity cDNA Reverse Transcription kit, Applied Biosystems, Cat. No. 4368814) to generate cDNA for the template in quantitative real-time PCR reactions, which was performed using the PowerUp SYBR Green Master Mix (Applied Biosystems, Cat. No. A25742). Expression level was normalized to expression of endogenous control gene GAPDH. Primer sequence for human ESR1 is 5 TGGGCTTACTGACCAACCTG 3 (forward) and 5 CCTGATCATGGAGGGTCAAA 3 (reverse); for human GAPDH is 5 GTCTCCTCTGACTTCAACAGCG 3 (forward) and 5 ACCACCCTGTTGCTGTAGCCAA 3 (reverse).

HEL-ATF4 and UKE-1-ATF4 were obtained by lentiviral infection of HEL and UKE-1 cells respectively. pLVX-ATF4 mScarlet NLS (Addgene plasmid # 115969) were gifts from David Andrews73. HEK293T cells were transfected with the pLVXATF4 mScarlet vectors and the viral particles were collected in culture medium supernatant as described74. To generate stable HEL and UKE-1 cells expressing reporters, HEL and UKE-1 were infected by supernatant containing viral particles and selected with 2mg/mL of Puromycin (Thermo Fisher Scientific, Cat. No. A1113803) for one week. For ATF4 12-h monitoring experiments, 106 stably transfected cells were seeded in a 6-well plate with vehicle, thapsigargin (Tocris Bioscience, Cat. No. 1138) and 4OH-TAM. Cells were collected at specific time point (2H, 4H, 8H and 12H) and labeled with DAPI. The reporter fluorescence level was determined by selecting DAPI- cells.

For the immunoblotting of eIF2 phosphorylation and selective ATF4 translation, cells were treated with 4OH-TAM (10M, 15M and 20M) for 8h or with 10M for 2, 4 and 8h. Whole cell lysate was extracted from the RIPA lysis solution (Abcam, Cat. No. ab156034) with the Complete Protease Inhibitor Cocktail Tablets (Roche Applied Science, Cat. No. 11697498001) and PhosSTOP phosphatase inhibitor (Roche Applied Science, Cat. No. 4906845001). Equal amounts of protein (50g) were boiled for 5min in 1 Laemmli sample buffer (BioRad, Cat. No. 1610747) and separated on Mini-PROTEAN precast gels (BioRad, Cat. No. 4569034). The binding of antibody (ER Antibody (Santa Cruz, Cat. No. sc-8002, clone F-10, RRID: AB_627558), Phospho-eIF2 XP antibody (Ser51) (Cell Signaling Technology, Cat. No. 3398, clone D9G8, RRID: AB_2096481), eIF2 antibody (Cell Signaling Technology, Cat. No. 5324, clone D7D3, RRID: AB_10692650), ATF-4 antibody (Cell Signaling Technology, Cat. No. 11815, clone D4B8, RRID: AB_2616025), Phospho-Stat5 Antibody (Thermo Fisher Scientific, Cat. No. 71-6900, RRID: AB_2533991), Stat5 antibody (BD Biosciences, Cat. No. 610191, RRID: AB_397590), JAK2 antibody (Thermo Fisher Scientific, Cat. No. AHO1352, clone 691R5, RRID: AB_2536334), Phospho-JAK2 (Tyr1007/1008) Antibody (Cell Signaling Technology, Cat. No. 3771, RRID: AB_330403), Phospho-JAK2 (Tyr221) Antibody (Cell Signaling Technology, Cat. No. 3774, RRID: AB_390750), Anti-VDAC1/Porin Antibody (Santa Cruz, Cat. No. sc-390996, clone B-6, RRID: AB_2750920) and -Tubulin antibody (Sigma-Aldrich, Cat. No. T5168, clone B-5-1-2, RRID:AB_477579)) was detected using an enhanced chemiluminescence horseradish peroxidase (HRP) substrate (Thermo Fisher Scientific, Cat. No. 32106). All primary antibodies were used at a dilution of 1:1000, expect -Tubulin antibody, which was used at a dilution of 1:5000. Imaging and band quantification were carried out using Odyssey Fc Imaging System and Image J/Fiji Software.

Seahorse XFp Cell Mito Stress Tests were performed using Seahorse XF Cell Mito Stress Test Kit (Agilent Technologies, Cat. No. 103015-100) according to the manufacturers protocol on Seahorse XFe96 Analyzer (for cell lines) and Seahorse XF HS Mini Analyzer (for mouse bone marrow lineage-negative cells and human peripheral blood mononuclear cells) (Agilent Technologies). To perform the metabolic assays on cell lines, Seahorse XFe96/XF Pro Cell Culture Microplates (Agilent Technologies, Cat. No. 103794-100) were coated with Cell-Tak (Corning, Cat. No. 354240) in 0.1M sodium bicarbonate solution (pH 7.4) for 20min at room temperature, washed twice with water and stored at 4C one day before the assay. Cells were treated with 4OH-TAM for 2h and washed with XF Mito Stress medium (Agilent XF DMEM Medium (Agilent Technologies, Cat. No. 103335) with 10mM glucose, 1mM pyruvate, and 2mM glutamine, pH 7.4). Cells were then maintained in XF Mito Stress medium at 37C in an incubator for 1h to pre-equilibrate. For mouse bone marrow lineage-negative cells and human peripheral blood mononuclear cells, cells are seeded in Seahorse XFp PDL Cell Culture Miniplates (Agilent Technologies, Cat. No. 103722-100). In Cell Mito Stress Tests, the concentrations for oligomycin, FCCP and rotenone/antimycin A are 1M, 0.5M, and 0.5M respectively.

For the XF Real-Time ATP Rate Assay (Agilent Technologies, Cat. No. 103592-100), cells were washed with the ATP assay medium (Agilent XF DMEM Medium with 10mM glucose, 1mM pyruvate, and 2mM glutamine, pH 7.4). In Real-Time ATP Rate Assay, the concentrations for oligomycin and rotenone/antimycin A are 1.5M and 0.5M respectively. Data analysis was performed using the Seahorse XFe Wave software and statistics were analyzed in Prism 7.0.

For permeabilization assay, cells were washed and maintained in pre-warmed mannitol and sucrose buffer (MAS, pH 7.2) (220mM mannitol, 70mM sucrose, 10mM KH2PO4, 5mM MgCl2, 2mM HEPES, 1mM EGTA, 4mg/ml BSA), following by adding 1nM XF Plasma Membrane Permeabilizer (PMP) (Agilent Technologies, Cat. No. 102504-100) before running the assay. After the first injection of tamoxifen and vehicle control, mitochondrial activity was initiated by pyruvate (5mM), malate (2.5mM), and ADP (1mM) for measuring complex I-driven respiration, followed by succinate (10mM) and ADP (1mM) for complex II-driven respiration.

Cells were fixed in fixation solution (PBS solution with 2% paraformaldehyde, 0.1% glutaraldehyde, 150mM sucrose) for 30min at room temperature and then permeabilized in permeabilization solution (PBS with 0.1% Triton-X-100). After incubation of TOM20 antibody (Santa Cruz, Cat. No. sc-17764, clone F-10, RRID: AB_628381, 1:100), samples were treated with Image-iT FX signal enhancer (Thermo Fisher Scientific, Cat. No. I36933) for 30min, followed by two-hour incubation of 50M FLTX1 (MedChemExpress, Cat. No. HY-119437) at room temperature35,36. Cells were mounted by ProLong Diamond Antifade Mountant (Thermo Fisher Scientific, Cat. No. P36961) and visualized by LSM 980 Airyscan 2 (Zeiss). Colocalization analysis was performed by ImageJ plugin Colocalization Finder (https://imagej.nih.gov/ij/plugins/colocalization-finder.html).

Bovine heart mitochondrial membranes were prepared as described previously75. Assays were performed at 32C in 10mM Tris-SO4 250mM sucrose (pH 7.2) using 200M NADH in the presence of 1.5M horse heart cytochrome c (Sigma-Aldrich, Cat. No. C7752) and quantified by the absorbance of NADH (340380=4.81mM1cm1)75 in 96-well plates using a Molecular Devices Spectramax 384 plus platereader with Softmax Pro software. Catalysis was initiated by the addition of NADH, and rates reported are for the linear regression of the maximal rates. To bypass complexes III and IV, assays were performed in the presence of 1M Antimycin (Sigma-Aldrich, Cat. No. A8674) and 15g/mL alternative oxidase (AOX), which was prepared as described previously76. Hydroxytamoxifen was added to the assays from DMSO stocks, and compared to appropriate DMSO controls.

Mitochondria isolation was performed using the commercial kit (Mitochondria Isolation Kit for Cultured Cells, Thermo Fisher Scientific, Cat. No. 89874) according to the manufacturers protocol. In brief, 50 million cells pre-treated with 4-OH tamoxifen for 24h were harvested and collected in reagent A, followed by 2-min incubation on ice. Cells were then treated with 10L of reagent B and incubated for 5min on ice with vertexing every minute. After adding the reagent C, homogenized cells were centrifuged at 700g for 10min at 4C and the pellet was discarded. The crude fraction was centrifuged at 12,000g for 15min at 4C. While the supernatant was stored as cytosolic fraction, the pellet containing the mitochondria-enriched fraction was washed with reagent C and centrifuged at 12,000g for 5min at 4C. T

4-hydroxytamoxifen was separated using revrse phase LC separation with Acquity UPLC column (50mm2.1mm) T3 (C18) bonding and endcapping, packed with high strength silica (HSS) particle substrate. Sample volume of 5L was injected using Simadzu Nexera ultra-high performance liquid chromatography (UHPLC) (Shimadzu, Japan) coupled with Q-trap SCIEX 6500 (QQQ) mass spectrometer (SCIEX). The column oven temperature was maintained at 40C, with a flow rate of 0.4mL/min. A linear gradient was applied ranging for 5.0min ramping from 30% to 95% solvent (0.1% formic acid in acetonitrile). MS parameters for data acquisition using SCIEX 6500 triple quadropole system included: positive Electrospray ionization (ESI); Ion source voltage at 5500V; Source temperature at 550C; collision activate dissociation (CAD) at 8; Nebulizer gas (GS1) at 50; and Auxillary gas (GS2) at 60. 4-hydroxytamoxifen parent ion was monitored (major precursor [M-H]+ ions at m/z 388.0) and daughter ion (major fragmented product ion at m/z 72.2).

Further information on research design is available in theNature Portfolio Reporting Summary linked to this article.

View post:
Tamoxifen for the treatment of myeloproliferative neoplasms: A ... - Nature.com